Nosrdstrom Case Study Essay

1. The regional Manager of Human resources suggests that you start using a personality assessment too, such as the MBTI, in hiring new employees or your store. What are the benefits of this approach and what are the drawbacks. Now a days good service have become the most important value that a company no matter the industry need to have, therefore the need of employees who really enact it in their daily work is really important and it is in this value where personality plays and enormous part; personality is that thing that define who you are and how you understand the world, they way you act in an specific situation will completely depend on your personality which is constantly shaping depending on the experiences you have during your life time. Being this said an assessment tool, as an MBTI will help you foresee how a person would perform in a specific job with some specific needs and functions regardless of their studies. Note that sometimes this approach might mislead into assumptions of someone’s personality because of how it is perceived, the way we avoid the common errors of perception as first impression error, selective perception, stereotypes among others will succeed or disorientate the approach and will end up with no correct personality description which will mislead you into wrong conclusions. 2. Can a friendly, customer-oriented attitude be developed in person? Can Nordstrom â€Å"train† employees to prioritize making customer happy, or it is purely a matter of personality? Yes it can be developed in a person, but it would depend on its personality how this skill will shine and if this value will be enacted. Something like service, which is customer-oriented attitude, will depend on how this person  understand the world, how he communicate and what are his preferences. Being this said, it is not something that depends whether on the training or in the personality, there has to be a smooth connection between both. Nordstrom for example does an incredible work by hiring people which personality allows them to perform great on their customer-oriented service, a skill they train into each of their employees and due to their personality it is easily adapted and enacted since it is felt natural. 3. Describe the ideal Nordstrom salesperson in terms of the personality traits that are involved in core self-evaluation (CSE). Warmhearted, conscientious, and cooperative. Wants harmony in the environment, works with determination to establish it. Likes to work with others to complete tasks accurately and on time. Loyal , follows through even in small matters. Notices what others need in their day-to-day lives and tries to provide it. Wants to be appreciated for who he or she is and for his or her contribution.

The Trauma Radiography Procedure Health And Social Care Essay

Trauma skiagraphy is one process contain in medical imagination. It is rather exciting or nerve-racking for radiographers. For certain radiographers maybe it is really nerve-racking because there are a batch of unexpected instances that required a batch of technique to use during plants in exigency room. To guarantee that the injury skiagraphy is non nerve-racking the radiographer must ache and hold a batch of accomplishments plants in exigency room. First of all, I would to specify that the definition of injury is as sudden, unexpected, dramatic, forceful or violent actions. In United states the individuals which age around 34years old can take to decease when there are in trauma skiagraphy. This statistics excludes suicide and homicide-related decease. Trauma, homicide and self-destruction rank foremost, 2nd and 3rd severally as the taking causes of decease in individuals age 15-24 old ages. Emergency medical attention of 10 is difference between life and deceases when knowing or u nitintentional injuires occur. Many types of installations provide exigency medical attention runing from major, metropolitan centres to little outpatients clinics in rural country. The term traumatic centres signifies a specific degree of exigency degree of exigency attention as defined by American College of Surgeons Commision on Trauma. Trauma centre are categorized into four degrees of attention. Level 1 is the most comprehensive and flat 4 is the most basic. A degree 1 is halfway normally a university based centre, research installation or big medical centre. It provide the most comprehensive exigency medical attention available with complete imaging capablenesss 24 hours a twenty-four hours. All types of forte doctors are available on sites 24 hours a twenty-four hours. Radiographers besides available for 24 hours a per twenty-four hours. A flat 2 centre likely has all of the same specialised attention available but differs in that it is non research or learning infirmary and some forte phcsicians may non be available for 24 hours. Level 3 possibly located in smaller community where degree 1 and 2 attention is non available. Level 3 besides possibly did n't hold any forte but they are stand by to reassign patient to a larger injury centre. A degree 4 is halfway possibly is non in infirmary at all but instead a clinic or outpatient setting.these installations normally provide attention for minor hurts every bit good as offer stabilisation and arrange for transportation of more serious hurts to a larger injury centre. The trauma incident that is normally happen that is including blunt, explosive, perforating and heat consequence in hurts. The illustrations of blunt injury that is motor vehicle accident ( MVA ) , which includes bikes incidents and hits with prosaic, falls and aggravated assault. The penetrating injury is includes gunshot lesions, stab lesions, impalent hurts and foreign organic structure consumption or aspiration. Explosive injury causes hu rts by several mechanism including force per unit area daze moving ridge, high speed missile and Burnss. Nathan birnbaums possibly because by a figure of agents including of fire, steam and hot H2O, chemicals, electricity and cryopathy. Specialized Equipment Time is critical component in injury skiagraphy in salvaging the patients. To minimise the clip required to acquired diagnostic xray images many exigency room that is located an imaging equipment to guarantee the process can be done every bit speedy as possible. The injury radiogram besides must non to travel a batch the patient and required more maneuvering of the tubing and images receptor. Specialized injury equipment is design to supply for a greater flexcibility in xray tubing and Ir maneuvering. These equipment is to assist the patient and minimise the motion of the hurt patient while executing imaging process. Additionally the exigency room are equipped with specialised beds or stretchers that have movable tray to keep the IR. This moveble tray can let the used of nomadic radiographic unit and eliminates the demand and hazard of reassigning an injured patient to radiographic tabular array. Mobile skiagraphy is midely utilised in the exigency room.many patient will hold hurts t hat prohibit to reassign to a radiographic tabular array or their conditions possibly excessively critical to disrupt intervention. Trauma radiographers must be competent in managing nomadic radiographic units on about any portion of the organic structure and utilizes accoutrement devices needed to bring forth quality nomadic images. Mobile fluoroscopy units normally referred to as c-arm because of their forms are going more platitude in exigency room. C-arm are design to cut down fractured process, foreign organic structure localisation in limb and cut downing articulations disruptions. Positioning assistance are necessary in trauma skiagraphy. Spoges, sandbags and the originative used of tapes are frequently thee most utile radiographer tools. Most trauma patient is unable to keep the needed places as a consequence of strivings or impaired consciousness. Other patients can non be moved into proper places because to make so would worsen their hurt. Proper used of positioning assist ance is assist in speedy process to suit the patient conditions. Grids and IR holders are necessities since many projections required the used of a horizontal cardinal beam. Inspect grids routinely because harm grid will be frequently cause image artefact. Exposure Factor The of import that should be considers in taking images of trauma patient is gesture. The shortest possible exposure clip that can be set should be used in every process except when take a breathing technique is desired. Unconscious patient are unable to suspend respiration for the exposure. Conscious patient are normally in utmost hurting and unable to collaborate for the process. Radiographic exposure factor compensations possibly required when devising exposure through immobilisations devices like a spine board or backboard. Most trauma patient arrive at the infirmary with some type of immobilisations devices. Pathological factors besides should be see when puting proficient factors. For case internal hemorrhage in the abdominal pit would absorb a greater sum of radiation than a bowel obstructor. Positioning of the patient The primary challenge of the injury radiographer is to obtain high quality, diagnostic images on the first effort when the patient is unable to travel into the coveted place. Many methods are available to accommodate a everyday projection and obtain the coveted images of the anatomical portion. To minimise hazard of worsening the patient status, the xray tubing and IR should be place instead than the patient or the portion. For illustration place the the stretcher adjacent to the perpendicular bucky or unsloped tabular array every bit frequently as the patient status allows. This location enable accurate placement with minimum patient motion for cross-table sidelong images ( dorsal decubitus places ) on legion parts of the organic structure. Additionally the grid in the tabular array or perpendicular bucky is normally high ratio than those used for nomadic skiagraphy, so image contrast is improved. Another technique to to increase efficiency while minimising patient motion is to take all of the ap projections og the requested scrutinies, traveling superiorly to inferiorly. Then execute all of the sidelong projections of the requested scrutinies traveling inferiorly to superiorly. The method travel the xray tubing in the most expeditious mode. When taking radiogram to laocalize a perforating foreign object or slug, the entryway or issue lesions should be Markss with radiopaque marker that is seeable on all projections. Radiographer Role in Trauma Radiography The function of radiographer within the ER finally depends on the section protocol and staffing, every bit good as the extent of exigency attention provided by the installation. Regardless of the size of the installation the primary duties of radiographer in an exigency state of affairss include the followers ; Perform quality diagnostic imagination as requested. Practice ethical radiation protection Provide competent attention It is impossible to rank these duties because they occur simulataneously and all are critical to quality attention in Er. Diagnostic Imaging Procedure Producing a high quality diagnostic images is one of the more obviously functions of radiographer. A radiographer in the injury environment has the added duties to execute that undertaking expeditiously. Efficiency and productiveness are common and practicals ends for radiology section. Diagnostic imagination in ER is paramount to accurate timely and frequently life salvaging diagnosing. Radiation Protection in Trauma Radiography One of the most indispensable responsibilities and ethical duties of injury radiographer is radiation protection of the patient the members of the injury squad and ego. In extremely critical attention state of affairss members of the injury squad can non go forth the patient while imaging processs are being performed. The injury radiographer must guarantee the other squad members are protected from any unneeded radiation exposure. Common patterns should minimally include the undermentioned ; Close collimation to the anatomy of involvement to cut down spread Gonadal screening for the patients of child bearing age ( when making so does non interfere with the anatomy og involvement Lead aprons for all forces that remain in the room during the process Exposure factors that minimize patient dosage and spread radiation Announcement of hindering exposure to let unneeded forces to go out the room Considerations besides must be given to patients nearby stretchers. If there are less than 6 pess of the distance from the xray tubing, appropriate should be provided. Some of the greatest exposure to patient and medical forces are from fluoroscopic processs. If the c-arm fluoro unit is used in er particular safeguards should be topographic point to guarantee that exposure clip is kept minimal and all forces are have oning protective aprons. Patient Care As with all imagination processs trauma processs required a patient history. The patient may supply this, if he or she is witting or the attending doctor may inform you of the hurt and the patient position. If the patient witting, explicate what you are making in item and in term the patient can understand. Listen to the patient rate and mode of address which may supply penetration into his or her mental and emotional position. Make an oculus contact with the patient to supply comfort and reassurance. Keep in head that a trip to the ER is emotionally nerve-racking event, irrespective of the badness of hurt or unwellness. Radiographers are frequently responsible for the entire attention of the trauma patient while executing diagnostic imagination process. Therefore it is critical that radiographers invariably assess the patient conditions, acknowledge any mark of diminutions or hurt and study any alteration in the position of the patient conditions to the go toing doctor. The injury r adiographer must be good versed in taking critical mark and cognizing normal scopes, competent in cardiorespiratory resusicitation, disposal of O and covering with all types of medical exigencies. The radiographer must be prepared to execute these processs when covered by a standing physician order or section policy allows. Additionally the radiographers should be familiar with the location and content of the grownup and peadiatric clang carts and understand how to used suctioning devices. The familiar ABC air manner external respiration and basic support life technique must be invariably assessed during the radiographic process. Ocular review and verbal inquiring enables radiographer to find if the position of patient alterations during the process Common Injuries Happen Hypovolemic or hemorrhagic daze is medical status where there are abnormally low degree in blood plasma in the organic structure such that the organic structure is unable to decently keep blood force per unit area. Vasovagal reactions is besides called a vasovagal onslaught or situational faint. It is a physiological reaction of nonvoluntary nervous system or normal physiologic response to emotional emphasis. The patient may kick of sickness, flowers, experiencing lightheaded and loss consciousness for several seconds. Cerebrovascular accident is normally called a shot caused by thrombosis, intercalation or bleeding in the vas of the encephalon. Best Practice In Trauma Radiography Speed- injury radiographers must bring forth high quality images in shortest sum of clip. Celerity in executing a diagnostic scrutiny is excessively critical to salvaging the patient life. Many practical method that addition scrutiny efficiency without giving image quality. Accuracy – Injury radiographers must supply accurate images with a minimum sum of deformation and the maximal sum record item. Shortest and minimising the exposure clip and uncontrolled patient gesture. Quality – Quality does non hold to be sacrificed to bring forth an image rapidly. Make non fall into the trap of the patient status as an excuses for careless placement and accepting less than high quality images. Positioning – Careful safeguards must be taken to guarantee that public presentation of the imaging process does non worsen the patient hurts. The aureate regulation of two projections at he right angle from one another still applies. Equally frequently as possible, place the tubing and the IR instead than the patient, to obtain the coveted projections. Practice Standard Precaution – Exposure to the bloody and organic structure fluids should be expected in the injury skiagraphy. Wear baseball mitt, mask and the gown when appropriate. Place IR and sponges in nonporous plastic to protect from the organic structure fluids. Wash hands decently and maintain all equipment Is clean and ready to used. Immobilization- Never take any immobilisation device without doctors order. Supply proper immobilisation and support to increase patient comfort and minimise hazard of gesture. Expecting – Anticipating required particular projections or diagnostic processs for certain hurts makes the radiographer critical portion of the ER squad. For illustration patient necessitating surgery by and large required an xray of the thorax. Fracture of pelvic girdles frequently required cystogram to find the position of urinary vesica. Bing prepared to execute these scrutiny rapidly and understand the necessity of the extra images instill assurance in and creates an grasp for the function of the radiographer in exigency scene. Attention To Detail – Never leave a trauma patient or any patient unattend during imaging process. The patient status may alter at any clip and it is radiographer duty to observe these alterations and describe them instantly to go toing doctor. If you are unable to treat images while keeping oculus contact with your patient, call for the aid. Person must be with the injured patient all the clip. Attention To Department Protocol And Scope Of Practice – Know the section protocol and pattern merely within your competency and abilities. The range of pattern for radiographer varies from province to province and from state to state. Be certain to analyze and understand the range of your function in exigency scene. Do non supply or anything by oral cavity. Always ask the doctor before giving the patient anything to eat or imbibe no affair how relentless the patient may be. Professionalism- Ethical behavior and professionalism in all state of affairss and with every individual in demand of all wellness attention professional but the conditions encounter in the ER can be peculiarly complicated. PATIENT PREPARATIONS It is of import to retrieve that the patient has endured and emotionally distressing and straitening event in add-on to physical hurts he or she may hold sustained. If the patient is witting, speak calmly and look straight in the patient eyes while explicating the process that have been ordered. Make non presume that the patient can non or will react. Check the patient exhaustively for the point that might do an artefact on the images. Explaining what you are taking from the patient and why. Be assure to put all the removal personal effects particularly valuable in the proper container used by the installation or in the designated secure country. Every installation has process sing proper storage of patient personal belonging. Be certain to cognize the process and follow it carefully.

Ford Focus and Ford Motor Company Essay

When Alan Mulally took over as Chief Executive Officer at Ford Motor Company in 2006 the organization was losing billions of dollars. According to Tony Schwartz (2010), â€Å"It had just come off reporting a $14. 6 billion loss for 2008, its fourth losing year in a row† (para. 1). The article Alan Mulally-Making Ford a Model for the Future illustrates the progress of Alan Mulally and the four simple principles that are making the company become profitable. Principles are important in any organization and an employee needs to feel important and motivated to come to work. These are a few of the principles that Alan Mulally have implemented since 2006: Stand for something beyond profit. Rally your employees around a shared mission. Practice a realistic optimism. Tell the truth without fear (Schwartz, 2010). The turnaround at Ford Motor Company was not overnight. He invested in the vision â€Å"One Ford† which has the idea of creating vehicles that will appeal to both American and European consumers by utilizing a common design theme that would move beyond the three-bar infatuation of the United States (Lavrinc, 2007). The transformation of the American icon was due to the One Ford vision and one year after 2008, Ford Motor Company reported a profit of $2. 7 billion. This transformation would not have happened if Alan Mulally did not take over in 2006. The ethical behavior by Ford Motor Company’s Chief Executive Officer has shown to be a true testament to future CEO’s in the global market. When the company raised $23. 5 billion to finance the restructuring and accelerate the investment in new products it shows great leadership during the Great Recession (Bartiromo, 2011). This American icon is 110 years old and recently had the strongest third quarter profit in history in 2012. This would not have happened without Alan Mulally reducing the brands of Aston Martin, Jaguar, Mazda, Land Rover, and Volvo into the two main components that a person would vision on the road today Ford and Lincoln. The leadership is beyond extraordinary and models like the Ford Focus is now one of the country’s best selling cars (Schwartz, 2010). The business environment is multifaceted with enormous challenges that face the global market. By focusing attention on a vision, the leader operates on the emotional and spiritual resources of the organization, on its values, commitment, and aspirations. The manager, by contrast, operates on the physical resources of the organization, on its capital, human skills, raw materials, and technology. The results that an individual observes currently are in direct correlation of the actions over the last five years. Ford has now paid back the $23. 5 billion that was taken out in 2006 to finance the restructuring and investment of new products. The company has started to hire and bring jobs back to the United States. According to Schwartz (2010), â€Å"Mulally is taking an old-school industrial company and turning it into a model of how modern company ought to be run† (para. 3). Using the PESTEL Analysis to capture macro-environmental forces and including part of the Ansoff Product/Market Opportunity Matrix Ford Motor Company can thrive on market penetration strategies. The following PESTEL Analysis shows the six factors that are the biggest weaknesses and strengths perceived to be the primary data in the next five years for the automotive giant.

Organizational Culture Research Paper Example | Topics and Well Written Essays - 2000 words

Organizational Culture - Research Paper Example An organization that sticks to its organizational culture builds a good reputation with both its internal and external environments. On the other hand, organizational commitment refers to the psychological attachment and willingness for an employee to continue working in an organization. This paper seeks to expound on organizational culture and organizational commitment of employees according to a survey carried out on primary school teachers in Turkey. Clearly in the book, in any organization, culture establishes norms in the structure of the organization developing a social organism with specific beliefs, values, and behaviors1. Therefore, just as depicted the article, the book confirms the fact that the employees learn and focus on the organizational expectations on the values and behaviors in line with the organizational culture2. In addition, organizational culture guides the framework for leadership styles, work environment, and work strategies. Research shows that there exist a direct connection between organizational culture and performance. Positive and supportive organizational culture promotes performance as well as creativity and innovations. There is a clear interaction among organizational culture, vision and mission, leadership and management, interpersonal relationships and organizational images. A research conducted among teachers indicates that personal attributes contribute to organizational culture. It shows that beginner teachers have no interest in their new schools hence they do not take organizational culture with seriousness. They only embrace competition culture since they want to secure attention and recognition. Another study conducted among secondary school teachers shows that school principals embrace more positive and stronger organizational culture than their subordinates. This means that top management is more interested in organizational culture than the middle and line managers are. Generally, top management is associated with strategy formulation and disciplinary responsibility, therefore, calling for commitment to the organizational culture. The research in both the publications further indicates that, not all female teachers and beginners trust their colleagues. This is because new teachers have not understood and fitted in well with the organizational culture. However, female teachers do not trust male dominated organization for the fear of intimidation and dishonest. This lies under the masculinity verses femininity grouping that reflects on gender dominance in an organization. Gender dominance translates to gender roles, cultural values, and power relations. In conflict management, different aspects of culture are emulated as depicted in the publications. For instant, the force is resorted in individual cultures whereas in collective culture, compromising, withdrawing and problem solving are embraced. In conflict management, both male and female embrace different strategies. For example, male emplo yees use force to solve their individual conflict while the female prefers compromising in conflict management. This emerges due to disharmony between personal and collective goals. Collective culture focuses on the emotional dependence of the whole organization while individualism focuses on individual goal3. Organizational cult

You are What you eat Essay Example | Topics and Well Written Essays - 750 words

You are What you eat - Essay Example is a documentary which seeks to portray the hazards of unhealthy eating and its deprecations. The article seeks to convince its viewers that eating natural foods and avoiding industrialized/manufactured foods is suitable for people’s health both in short and long term. The film received mixed reactions from both its critics and supporters, but generally it did achieve its primary objective of sensitizing the people against industrialized foods of which was a noble cause (Top documentary films). Hence, it is essential to choose carefully what one eats as it will determine how healthy the body will be. The documentary Food Inc. was directed by Robert Kenner and co-produced by Eric Schlosser who is also the author of Fast Food Nation. The film explains the situation which arises due to people consuming industrialized foods. It also offers a rejoinder through the president of Stoneyfield Farm which is a highly successful organic yoghurt farm. The film also highlights the acquisiti on of previously independent businesses by multinationals. Examples of such businesses include Kasha which was taken over by Kellogg and Cascadian Farm which was taken over by General Mills. Furthermore, the film portrays how dishonest some farmers are by showing an interview on Joel Salatin, the philosopher farmer from Polyface Farm who shamelessly guts a chicken while explaining how to farm honorably. There is also the issue of access and cost of the health oriented food where a customer drives for five hours so as to pay a premium for Salatin’s products (Top documentary films). One of the film’s sub claims is that most farms which grow organic food do so because of their own financial gain but not for the sake of the buyer and food consumer. This means that the proprietors of the farms can easily drop organic farming if the returns were matching expected profitable levels. A perfect example is Joel Salatin who is a philosopher farmer and is eating chicken while advi sing people on how to practice honorable farming. This clearly shows that even though such farmers know the advantages of organic farming, they are still not ready to abandon the unhealthy foods by consuming the food that they grow and sell to others. The situation also emphasizes on the fact that these categories of farms’ proprietors do not have the consumers’ interests at heart, but instead they engage in organic farming because they are assured of a ready market for their organic products. This market is made up of those people who are keen on what they eat and are aware of the effects foods have on their bodies. The farmers seem to be in the right form of business because their products are in demand and are selling at relatively high prices. This is justified considering the customers who drive for five hours just to get the organic products at a premium rate. Hence, it is justifiable to say that the motive of the film i.e. to portray the farm owners as people wh o engage in organic farming just for profit purposes was successful and effective. Many large companies are manufacturing food because it is much more profitable and less consuming. This is supported by the fact that industrialized foods take a shorter period to be delivered for consumption when compared with organic foods. Despite the disadvantages that come with industrialized foods, they are also beneficial in some ways. Some of the biggest advantages include the fact that they can withstand harsh conditions and are less prone to diseases and infections. These make the foods popular because many farmers and business people prefer to deal with foods that have minimal risk (Johnson 56). However, the advantages of industrialized foods are just a small incentive when compared with

Marketing - Purchase Decision & Consumer Behaviour Assignment

Marketing - Purchase Decision & Consumer Behaviour - Assignment Example Issues which contributed to choosing the brand and buying the product I have been using this brand for a long time, and I seem to like it. I always buy yogurt which I take when I feel like eating something during the day. Date 21 July 2013 Items 1X Non-stick frying pan Cost $204.00 Seller Kleenmaid/ Compass Capital Partners Time spent on making the decision One month Effort put into decision making process Low involvement Substitute products or competing brands This decision was not made in light of the brand of the product. I only needed a non-stick pan for doing my frying. Issues which contributed to choosing the brand and buying the product I needed a non-stick frying pan, and a friend suggested this particular brand to me. Date 21 July 2013 Items 2X Temptin Chocolate biscuits Cost $24.00 Seller Dick Smith Foods Time spent on making the decision None/ Impulse buying Effort put into decision making process Low involvement Substitute products or competing brands There are a number o f both substitute products as well as a number of competing brands. These include the Tim Tam biscuit brand among others. Issues which contributed to choosing the brand and buying the product This was an impulse buying, which was not determined by any brand or utility considerations. I do not have any considerations for candy brands and buy any brand. Date 21 July 2013 Items A bottle of Aglianico red wine Cost $395.00 Seller Brown Brothers Milawa Vineyard Time spent on making the decision

Toxic Liquid Waste Incinerator Essay Example | Topics and Well Written Essays - 1250 words

Toxic Liquid Waste Incinerator - Essay Example Stack air emissions are gaseous, vapor, and particle-bound by-products of combustion. Facilities also have fugitive air emissions, which are released into the air from process points other than stacks (e.g., equipment leaks, wind-blown dust). The design of an incinerator, including waste and residual handling, largely determines the number of fugitive air emissions that might occur. Incineration facilities also generate solid and liquid residuals. These typically include wastewater from air pollution control devices and solid wastes, such as ash that remains in the combustion chamber and sludge that settles from wastewater treatment operations. In a waste liquid incinerator, the alkali waste liquids are recovered, the organic waste liquids are thermally decomposed and the hazardous waste liquid is made nonhazardous. All waste must be thoroughly characterized before they arrive at the incinerator and their contamination levels are known before they can be treated. Liquid wastes are stored primarily in tanks which have passive vents to the atmosphere. All vapors released from tanks first pass through Adsorption filters that capture volatile chemicals which might otherwise enter the air. The liquid wastes are piped directly into the incinerator, either to the rotary kiln or to the afterburner. In the primary combustion chamber, the inside temperature is at least 1580 °F (temperature varies depending on the type of waste treated). This process generates gases which pass into the secondary combustion chamber for further treatment. The incombustible material in the waste leaves the rotary kiln in the form of ash which drops into a water pool and enters into the residual management part of the process. In the secondary combustion chamber, some liquid waste is sprayed directly into the afterburner for treatment purposes. The organic gases generated in the rotary kiln are destroyed when exposed to the temperature of 2205 °F for at least 4 seconds.  Ã‚  

Virtual Tours vs. Written Word Assignment Example | Topics and Well Written Essays - 1000 words

Virtual Tours vs. Written Word - Assignment Example One can only explore the virtual world to the extent of seeing the physical features of the place. This limits the experience compared to actual visits. For this reason, virtual tours are very good in the marketing of a place to other people. The rough feel of a place can be. Travel agencies and countries can, therefore, manipulate the technology and use it to promote their own country’s tourism industry (Griggs 2014).  There are different companies whose version of virtual reality is as precise as Sony’s 3D glasses. Google maps, for example, has a classic simulation of the United States of America. A person that has not been to the continent can easily search a state, and get a precise version of the place. It is important to note that the difference in the way that the company has simulated the place on the ground is different from the actual reality. However, the features that are on the ground are very accurate.   The technology is far from completion. Scientist s are working on n audio version of virtual reality to complement the video functionality. The technology is called binaural audio. One of the most impressive features of this technology is that the sound that one hear is produced by simulating the process that humans have when hearing their reality. The resulting a replication of the sound that is in the real world. One of the most impressive features of this technology is its ability to capture the sound in the same way that the human ear capture sound. It is by far the most important and technologically advanced means of hearing things.

Communist manifesto Essay Example | Topics and Well Written Essays - 1500 words

Communist manifesto - Essay Example Not only were the form of governments and personnel altered but the entire basis of government were changed leading to emergency of society encompassing gender roles, human rights, nationality, and social class. It is noted these revolutionary social and political trends continued and became established in the nineteenth century, manifested through nationalist and democratic uprisings and movements against foreign or arbitrary rule throughout Europe, in the campaign against slave trade and slavery in the transatlantic ocean, and in to some extend demanding gender equality (Weightman 2010, 23). Emergence of industrial revolution led to emergence of another wave which reinforced revolutionary dynamic. Social, economic, and political changes emerged at the end of 19th century sweeping across the globe. Industrial revolution led to advances to substitute inanimate and machine sources of power for replacement of domestic and craft guilds production and human labor by the reformulation of business into cartels or corporation and manufacturing systems of the factory. This approach was similar to the replacement of the feudal rulers with political revolutions with new forms of government establishment and election of leaders. Similarly, industrial revolution was analogical to political revolutions which were exemplified through increased involvement of citizens in the government. This was in the sense that the resulting organizational and technological changes led to an impressive increase in production resulting into industrial society’s economic growth (Anderson 2011, 21). Effects of industrial revolution were felt in regions such as United States, Belgium, France, and Germany leading to emergence of new manufacturing cities. As a result, new class differentiation emerged and a new form of labor was conceived such as the middle class and the skilled labor respectively. Nevertheless, industrial revolution gave birth to rampant exploitation of workers and unplan ned urbanization calling for government regulations and interventions. Responses were manifested through Public Health Boards, Poor Laws, and Factory Acts. Evolution of labor unions was as a result of workers gaining the rights to vote. Socialist movements emerged due to resistance of workers demands leading to Karl Marx reasoning that was presented in Communist Manifesto which claimed that capitalist revolutionary overthrow was the only means for workers to emancipate themselves. On the contrary, Americans and Europeans expanded their influence and power due to the technological, organizational, and financial resources. Colonization, military domination, economic encroachment in the non-industrialized states was mated by little resistance thus resulting into new imperialism (Anderson 2011 33). Property rights exalted enlightenment to the status of a bulwark of liberty. Power in the older Europe accompanied property; however, aristocratic rule was the inevitable belief that justifie d the power. It was believed that wealth was right given by God and the traditional Christianity was conceived to balance this wealth. Nevertheless, European civilization was profoundly affected by industrial revolution. Industrialists viewed themselves as creators of wealth. Significant movement was the gradual expansion of voters’ rights which was initially focused on the working men but later included the women. Economic security and independence was argued to be achieved through the perception of liberty. The conception was based on the notion that natural laws yielded freedom rather than the theological

Purpose of Art Essay Example | Topics and Well Written Essays - 500 words

Purpose of Art - Essay Example The mood was somber yet violent depicting an ongoing fierce battle – field with a raging battle fought in defiance between male and female in order to gain supremacy. Heart of Andes was by artist Fredric Edwin Church who was born on the 4th of May 1826, in Hartford, Connecticut. He was an American landscape artist who always used a dimension of spirituality in his work and this painting was commissioned in 1859.   Interpretation of the meaning -.Beautifully executed piece of work where the artist brings out the beauty and serenity of the landscape. The meaning portrayed here is that it is possible for human beings to be one with God’s bountiful nature without destroying it. He had composed the painting with beautiful trees, rivers and mountains which remind us that it is impossible to imagine our world without them. Mood – The mood that the painting denotes is one of peace and calm showing that the artist would have been in a very peaceful mood while painting this picture. It kindles the audience to reflect on the wonderful gift of nature in all its beauty. The Volga  Boat - men,  was by ILYA Repin, a Ukrainian artist born in 1844. He was given extensive and intensive training from his childhood and became an icon painter since then. He entered St. Petersburg at the age of 19 during the time of the rebellion,  when young artists refused to work on any mythological subject but instead wanted to do  real life subjects. The Barge Hollows of Volga 1817- 1873 was his first major work. He was introduced to impressionism when he went to Paris.   Interpretation of the meaning - It shows the hard or harsh reality of life. It also depicts cheap labor almost amounting to slavery. The sad  expression on each face tells that they cannot escape. The sad and tired lines on their faces  and the dragging of  their feet give the mood of

Plant and Animals Essay Example for Free

Plant and Animals Essay Topic: why are some kinds of animals on the verge of extinction? Nowaday, the number of animals in the world is reducing that people is main reason. The growth of the population, the increasing needs of human life and the advancement of science and technology has affected animals. For example, people made medicines from horn of rhino, so they killed a lot of rhino result in this species going to extinct. Almost all types in the past, animals lived on earth were extinct and vanished in a natural way because of this reason or the other. One of the causes contributing to the extinction of animals is environmental change. Earth has existed for more than tens of millions of years and has a lot of changed, so the natural environment has changed. It causes which animals could not adapt. Therefore, animals disappear to spontaneously without interaction of human. For example, the dinosaurs that have ever existed on earth have become extinct long time ago because of climate change. In addition, when the number of individuals decreased leading to ecological imbalance. For example, the food of tiger is the antelope; if the number of antelope is down, the number of tiger is down too. Therefore, they extinction is inevitable. Next, the main cause of animal extinction is over-exploitation of forests. Forest is the main habitat of most species of land animals but people need wood as raw materials. So, they cut a lot of tree that makes soil erosion. According to data from wikipedia, 20,000 hectares lost every day and 47% of the forest area decreased each year. Therefore, the environment of animals was shrinking. Animals struggle to compete for living space. For example: a tree in the Amazon forest in Peru also is a haven for over 40 species (wikipedia) when people cut it off, all arboreal ants will go up another tree of ants other. It makes the weaker species will die and extinction. Finally, the most prominent cause of extinction of animals is excessive hunting by humans. Rare animals are very valuable on the market. Most of them are used as food, medicine, or decoration. They bring a lot of money for the hunter. Thus, they hunted all including immature animals. That make animals do not have time to recover in time lead to mass extinction of rare species in the world. For example, a recent catastrophic mass extinction took place at Lake Victoria, the longest lake in Africa. The mass extinction seems to happen more quickly by the people. â€Å"Nile† tilapia species can be up to 2m long and weighing up to 60kg, providing resources for export. In short, excessive hunting is main cause of extinction of animals. Summary, the animals are extinct too much. For many reason, the cause of extinction in animals such as environmental change, over-exploitation of forests, and excessive hunting. Thus, people have measures to protect the animals going extinct.

The Boeing Company Essay Example for Free

The Boeing Company Essay Soon to celebrate a 100-year anniversary, The Boeing Company was founded in 1916 and had 28 people on its payroll. Today, The Boeing Company has more than 170,000 employees, in 50 states and 70 countries and is the largest manufacturer of commercial airplanes and military aircraft (â€Å"The Boeing Company,† 2012). Boeing is structured around a business model that sets it apart from other companies. This model consists of six parts. They are chart the course, set high expectations, inspire others, find a way, live Boeing values, and deliver results. These six parts fall into the four categories of trust, conflict resolution, commitment, and accountability. Every Boeing facility adheres to this model, whether it is the Commercial Division or the Defense/Space Division. This is called the â€Å"One Boeing† approach with everyone working together for the common goal. Following this business model has allowed Boeing to become an industry leader. Employees are encouraged to work together and to trust and respect one another. Communications are expected to be honest, candid, and open. Above all, integrity and ethics are insisted upon. Every employee makes an ethics commitment each year. Boeing fosters an atmosphere were issues are focused on, not titles or positions. New ideas and ways to do things are welcomed and implemented if possible. Goals and objectives are clear and teams work together to define steps to get there. Quality is also focused upon an expected. If a quality defect is found, Boeing and its employees step up immediately even when it is uncomfortable to do so because it is the right thing to do, always. Diversity is celebrated and each person’s skills and strengths are added to the knowledge base. Even though there is an official hierarchy, Boeing continues its cultural theme into communication by keeping an open-door policy. Employees know that they can take their questions and concerns to anyone, even the president and CEO of Boeing, without fear of retribution. Internally, employees receive news updates every day via e-mail. These updates may include information on new customer contracts or aircraft deliveries, or they may include articles on individual or team accomplishments. There are weekly and monthly video broadcasts within each division, Commercial and Defense, that give a status of the company and on-going projects. Externally, Boeing maintains an extensive public website, advertises in magazines and on television (with actual employees doing the acting), and even publishes its own Frontiers magazine that is available to the public online and printed for customers, suppliers, and employees (â€Å"Frontiers Online Magazine,† 2012). Boeing sites also support their local communities. Employees volunteer their time with many charities and events, such as Earth Day clean-up projects, Habitat for Humanity, food banks, and education programs with local school children. When recent, weather related, incidents tore through the Midwest and damaged some of the homes of its employees, Boeing sites around the country immediately pooled together to send household goods and monies to help their fellow coworkers. Sites near to the affected areas sent people to help. It is not unusual for the Boeing family to pull together to help each other. The company’s core values are not just a flowery statement to satisfy customers and shareholders. Boeing’s values are the core of its business and its employees. There was recently a defective electrical panel found on a military aircraft as it was about to take its first flight. Boeing employees were mobilized within minutes of notification and had a replacement unit en route within an hour. An investigation was conducted and safeguards put in place to ensure the error never occurred again. In April 2011, a Southwest Airlines plane made an emergency landing in Arizona when a hole developed in the fuselage. Within minutes of the incident, thousands of Boeing personnel were already working on the problem. That particular airplane had been in service for 15 years, yet every Boeing employee stepped up to stand behind the product. These examples illustrate that Boeing and its employees live the Boeing values every day. With an established organizational culture that emphasizes working together as one cohesive unit and with open honest communications, it is no wonder that Boeing and its employees have set themselves apart as an industry leader. As stated on the Boeing website, â€Å"†¦our culture mirrors the heritage of aviation itself, built on a foundation of innovation, aspiration and imagination.

Epigenetic Control of Endocannabinoid Function

Epigenetic Control of Endocannabinoid Function Janis Szeremeta Epigenetic control of endocannabinoid function Prostate cancer is one of the most frequently diagnosed types of tumours in the male population worldwide. The endocannabinoid system, more specifically high expression of cannabinoid receptor 1 (CB1) in tumour tissue, has been associated with poor prognosis in prostate cancer and suggested as a prognostic marker. Epigenetic silencing has previously been shown to upregulate CB1 mRNA expression in colon cancer cell lines and to induce expression of normally silenced cannabinoid receptor 2 (CB2) mRNA in a neuroblastoma cell line. In the present study, potential effects of epigenetic modulation on the expression of 12 different components of the endocannabinoid system (receptors, synthetic and catabolic enzymes) were investigated in a prostate cancer and a neuroblastoma cell line. Additionally, two catabolic pathways were investigated in functional assays. In general, changes in mRNA expression levels produced by treatment with the epigenetic modulators, 5-aza-2-deoxycytidine and Tricho statin A were small, and, in the case of the catabolic enzyme fatty acid amide hydrolase in DU-145 prostate cancer cells were not accompanied by observable changes in hydrolysis rates. In SH-SY5Y neuroblastoma cells a low expression of monoacylglycerol lipase was found and this was also observed in functional assays. It is concluded that for the cell lines investigated, the epigenetic modulators tested do not modify the endocannabinoid system to any obvious degree, at least at the mRNA level. Since these experiments were conducted on a single cell line of a specific cell type only, introduction of alternative prostate cancer cell lines, such as PC-3 or LNCaP, might have different outcomes and should be considered for future experiments. Due to its involvement in a variety of physiological and pathophysiological conditions, such as obesity, pain, immunomodulation and cancer1, the endocannabinoid system has emerged as an important area of research. Endogenous lipid transmitters, the so-called endocannabinoids, act by binding and activating the G-protein coupled cannabinoid receptors 1 and 2 (CB1/ CB2). Endocannabinoid levels are tightly regulated by a network of synthesizing and catabolizing enzymes (Figure 1). Two lipid mediators, N-arachidonoylethanolamine (anandamide, AEA) and 2-arachidonoylglycerol (2-AG), remain the most thoroughly studied endocannabinoids to date. 2-AG is derived from hydrolysis of diacylglycerols (DAGs) containing arachidonic acid via diacylglycerol lipases ÃŽÂ ± and ÃŽÂ ² (DGLÃŽÂ ±/ÃŽÂ ²) and then hydrolysed to arachidonic acid mainly via monoacylglycerol lipase (MGL) but also by ÃŽÂ ±/ÃŽÂ ²-hydrolase domain containing 6 and 12 (ABHD6, ABHD12)2. AEA is derived from N-acylphos phatidylethanolamines (NAPEs) by hydrolysis via NAPE-phospholipase D (NAPE-PLD). It is inactivated by hydrolysis via fatty acid amide hydrolase (FAAH) and N-acylethanolamine acid amide hydrolase (NAAA) to arachidonic acid. Arachidonic acid is a substrate for many enzymes, including cyclooxygenase (COX) -1 and -2, 5- and 12-lipoxygenases (5/12-LOX) to produce prostaglandins, 5- and 12- hydroxyicosatetraenoic acid (5/12-HETE), respectively. Both 2-AG and AEA can also be hydrolysed to prostaglandin H2 derivatives via COX-23. Current modulators of the endocannabinoid system include a variety of selective pharmacological inhibitors for these enzymes which can be used to study their functional roles in the body (see Figure 1 for compounds used in this study). Figure 1: Simplified view of the endocannabinoid system. G-protein coupled receptors CB1 and CB2 are activated by lipid mediators, in this case 2-AG and anandamide (AEA) as well as by plant derived and synthetic compounds (not depicted). 2-AG and AEA are synthesized from diacylglycerol or N-acylphosphatidylethanolamine precursors and act locally. Both messengers are hydrolysed to arachidonic acid and/or prostaglandin H2 derivatives. Descriptions given in green were investigated towards changes in mRNA expression following epigenetic modulation treatment. Descriptions given in red show endocannabinoid metabolizing enzyme inhibitors. Abbreviations: Penta, Pentadecylamine (after Muccioli 20103). The endocannabinoid system is becoming a more and more important therapeutic target in cancer, and very interestingly, different types of cancer appear to react differently to changes in endocannabinoid balance, with oftentimes opposing effects ranging for example from pro- to antiapoptotic4. This shows why understanding how the endocannabinoid system is regulated in health and disease remains an important part of research. An important hallmark of cancer formation of cancer is the occurrence of epigenetic alterations5,6. Aberrant DNA methylation has been found in various types of cancer and effects vary between hyper- and hypomethylation states and in different types of cancer (see Kulis et al 20107). DNA methylation is usually associated with inhibition of gene expression. Cytosine nucleotides are methylated at the fifth carbon to form 5-methylcytosine, which can hinder transcription factor binding and therefore interfere with gene expression8. 5-Aza-2-deoxycytidine is a DNA demethylation compound that is able to replace and mimic cytosine in the DNA. In case of a cytosine replacement, DNA methyltransferases (DNMTs), that would normally catalyse methylation of cytosines, will now be bound covalently to 5-Aza-2-deoxycytidine, leading to degradation and depletion of DNMT protein levels and therefore a decrease of DNA methylation9. Note that this process is unspecific and generally decreases overall DNA methylation. Histone acetylation, a different type of epigenetic modification, is associated with activation of gene transcription. Occurring on lysine residues of histones, histone acetylation is associated with a charge neutralization of the positively charged histone molecules. This neutralization reaction is thought to decrease interaction between negatively charged DNA phosphate backbones and their positively charged histone counterparts, therefore increasing DNA availability10. Histone acetylation is regulated by an interplay of histone acetylases (HATs) and histone deacetylases (HDACs)11. Inhibition of HDACs may be used to constitutively activate histone acetylation mediated gene expression. Prostate cancer has become one of the most frequently diagnosed malignancies in men throughout Europe12. Current evidence suggests that high a CB1 receptor immunoreactivity is correlated to disease severity and outcome13. Several prostate cancer cell lines and human prostate cancer tissues have been shown to express CB1 receptors using various techniques, such as qPCR, immunofluorescence and western blotting13-16. There is evidence that CB1 expression is regulated epigenetically in colorectal cancer, where DNA hypermethylation lead to a loss of CB1 expression17. The same study found inhibition of epigenetic silencing (i.e. removal of DNA methylation) increased Cnr1 mRNA expression in seven out of eight colorectal cancer cell lines. A different study investigated the effects of two different epigenetic modulators, 5-Aza-2-deoxycytidine (Aza dC) and Trichostatin A (TSA), a histone deacetylase inhibitor, upon CB receptor expression in two different cell lines18. Inhibition of epigenetic silencing in Jurkat T cells increased Cnr1 mRNA expression in an additive manner but did not affect Cnr2 mRNA expression, whereas treatment of human SH-SY5Y neuroblastoma cells lead to induction of normally silenced Cnr2 mRNA expression, again in an additive manner, but no changes in Cnr1 mRNA. Whilst the above data implicate epigenetic regulation of CB receptors, it is not known whether it is seen in prostate cancer cells, and there is no data concerning the endocannabinoid synthetic and catabolic enzymes. In consequence, the present study investigated the effects of Aza dC and Trichostatin A treatment upon mRNA expression for 12 different endocannabinoid-related genes (see Figure 1). Differences that were found were investigated in hydrolysis experiments and changes in either AEA or 2-AG hydrolysis. In addition, since tumours are often located in hypoxic microenvironments19, cell lines were exposed to hypoxic conditions for increasing intervals up to 24 h and the same panel of endocannabinoid system components was investigated towards mRNA expression. Cells were either placed into anoxic incubation chambers or exposed to hypoxia mimetics such as Co(II)Cl220 or deferoxamine21. Drugs and Compounds Radiolabeled compounds ([3H]-2-OG (60 Ci/mmol)), [3H]-AEA (60 Ci/mmol)) were obtained from American Radiolabeled Chemicals Inc, St. Louis, MO, USA. URB597, JZL184, WWL70 were obtained from the Cayman Chemical Co. (Ann Arbor, MI, USA). Pentadecylamine, 5-Aza-2-deoxycytidine (Aza dC), Trichostatin A, Co(II)Cl2 were obtained from Sigma-Aldrich (St. Louis, MO, USA). Cell Culture Human DU-145 (prostate cancer, passage range 17 to 29) and SH-SY5Y (neuroblastoma, passage range 19 to 28) cells were expanded in Eagles Minimal Essential Medium (EMEM ATCC 30-2003) supplemented with penicillin, streptomycin (10,000 U/mL each, Gibco by Life Technologies) and 10% FBS (Gibco by Life Technologies) in 75 mL flasks at 37ËÅ ¡C with 5% atmospheric CO2. Cells were plated in 24 well plates with a total number of cells of 1.5 ÃÆ'- 105 for DU-145 and 2.5 ÃÆ'- 105 cells for SH-SY5Y per well overnight. Epigenetic Modulation using 5-Aza-2-deoxycytidine and Trichostatin A Following the overnight plating, DU-145 and SH-SY5Y cells were treated by replacing the old medium with a fresh layer of medium containing Aza dC (1  µM), Trichostatin A (25 nm), a combination of both, or vehicle (DMSO 0.1%) as control for 24 h. After 24 h hours, cells were lysed according to the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) instructions and mRNA was extracted. Exposure to Hypoxia/Hypoxia Mimetics Induction of hypoxia was achieved via two different methods. Cells were seeded into 24 well plates and either kept in a hypoxic environment or were exposed to the hypoxia mimetic Co(II)Cl2. A hypoxic atmosphere inside an airtight modular incubation chamber (Billups Rothenberg Inc, San Diego, CA, USA) was achieved by first flushing the medium with a hypoxic gas mix (1% O2, 99% CO2) at a rate of 3 L/min for 5 minutes. The old medium was replaced with a layer of flushed medium and plates were placed into the airtight chamber. The chamber was flushed with hypoxic gas at a rate of 20 L/min for 5 minutes (per manufacturers instructions22) and then incubated at 37ËÅ ¡C for either 2, 4, 6, 8 or 24 h. Co(II)Cl2 was used at a final concentration of 50 mM and cells were incubated for 2, 4, 6, 8 or 24 h. HIF1ÃŽÂ ± and HIF2ÃŽÂ ± mRNA levels were assessed for both procedures to evaluate induction of hypoxia. qPCR mRNA was extracted using the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit. mRNA (5  µg of total) was used for reverse transcription using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Thermo Fisher Scientific). qPCR reaction mixtures were prepared using the KAPA SYBR FAST qPCR Master Mix (2X, KAPA Biosystems, Wilmington, MA, USA) to a final Volume of 20  µL. Reactions were run on the Illumina Eco Real Time PCR system (Illumina Inc, San Diego, CA, USA) with an initial denaturation time of 10 minutes at 95ËÅ ¡C, 45 cycles of 10 seconds at 95ËÅ ¡C and 30 seconds at 60ËÅ ¡C and melting curve cycle times of 15 seconds at 95ËÅ ¡C, 15 seconds at 55ËÅ ¡C and a final step of 95ËÅ ¡C for an additional 15 seconds. Primers (Table 1) were synthesized at Integrated DNA Technologies (Coralville, IA, USA). Amounts of transcripts were normalized to ribosomal protein L19 (RPL19) and relative quantification was perf ormed using the ˆâ€  Ã‹â€ Ã¢â‚¬  Ct method. Table 1: primers used for qPCR experiments Gene Product Forward primer (5 to 3) Reverse primer (5 to 3) Abhd6 ABHD6 GATGTCCGCATCCCTCATAAC CCAGCACCTGGTCTTGTTTC Abhd12 ABHD12 GGCAGAAAGCTCTATAGCATCG CCTGTAGCCAAGGTCTGAATG Cnr1 CB1 CACCTTCCGCACCATCACCAC GTCTCCCGCAGTCATCTTCTCTTG Cnr2 CB2 1st pair CATGGAGGAATGCTGGGTGAC GAGGAAGGCGATGAACAGGAG CB2 2nd pair AAACAACTGGGACTCCTC GTCTAGAAGGCTTTGGGTTG Ptgs2 COX-2 AGCAGGCAGATGAAATACCAG ACCAGAAGGGCAGGATACA Dagla DAGLÃŽÂ ± CCCAAATGGCGGATCATCG GGCTGAGAGGGCTATAGTTAGG Daglb DAGLÃŽÂ ² TCAGGTGCTACGCCTTCTC TCACACTGAGCCTGGGAATC Faah FAAH CACACGCTGGTTCCCTTCTT GGGTCCACGAAATCACCTTTGA Hif1a HIF1ÃŽÂ ± GCTGATTTGTGAACCCATTCC TTCATATCCAGGCTGTGTCG Epas1 HIF2ÃŽÂ ± CACAGAGTTCTTGGGAGCAG ACCCTTTGCAGACCTTGTC Alox5 5-LOX ATCCAGCTCAACCAAATCCC ACCAGATGTGTTCGCAGAAG Alox12 12-LOX GATCCGAGGAGAGAAGCAATAC GGAGGCTGAATCTGGATGAC Alox15 15-LOX CGAGGGTTTCCTGTCTCTTTAC GCACCCAAGAGTACCAGTC Mgll MAGL GGAAACAGGACCTGAAGACC ACTGTCCGTCTGCATTGAC Naaa NAAA ATGGAGCGTGGTTCCGAGTT AGGCTGAGGTTTGCTTGTCCT Napepld NAPE-PLD ACTGGTTATTGCCCTGCTTT AATCCTTACAGCTTCTTCTGGG Rpl19 RPL19 CACATCCACAAGCTGAAGGCA CTTGCGTGCTTCCTTGGTCT [3H]-AEA Hydrolysis in DU-145 Cells The assay of Bjà ¶rklund et al. (2014)23 was used. Cells (1.5 ÃÆ'- 105 per well) were plated and kept overnight to allow for cell adherence. Subsequently, cells were treated with Aza dC (1  µM) for 24 h or left untreated as control. Non-enzymatic hydrolysis was measured in non-cell containing wells. Wells were washed with KRH buffer (120 mM NaCl, 4.7 mM KCl, 2.2 mM CaCl2.2H2O, 10 mM HEPES, 0.12 mM KH2PO4, 0.12 mM MgSO4 containing 1% BSA (Sigma Aldrich) followed by KRH buffer alone. KRH buffer containing 0.1% fatty-acid free BSA (Sigma Aldrich) was added to the wells and plates were kept in a water bath at 37ËÅ ¡C. Inhibitors (URB597 1  µM, Pentadecylamine 1  µM, URB597 and Pentadecylamine 1 µM each) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C. [3H]-AEA (diluted with non-radioactive AEA to give a final assay concentration of 0.5  µM) was added and plates were incubated for a further 15 minutes resulting in a total reaction vol ume of 400  µL. The hydrolysis reaction was stopped by adding 600  µL activated charcoal in 0.5 M hydrochloric acid and plates were kept on ice. Charcoal and aqueous phase were separated by centrifugation (2,500 rpm, 10 min.), 200  µL of the aqueous phase were recovered and mixed with 4 mL scintillation liquid (ULTIMA GOLD, PerkinElmer) for liquid scintillation radioactivity determination with quench correction. The [3H]-AEA used is labelled in the ethanolamine part of the molecule, and the [3H]-ethanolamine produced by the hydrolysis of [3H]-AEA does not adsorb to the charcoal, whereas the [3H]-AEA does adsorb24. [3H]-2-OG Hydrolysis in SH-SY5Y Cells Cells (2.5 ÃÆ'- 105 per well) were plated and incubated overnight to allow for cell adherence. Non-enzymatic hydrolysis was measured in non-cell containing wells. The assay used was the same as for [3H]-AEA hydrolysis, but using 0.5  µM [3H]-2-OG (labelled in the glycerol part of the molecule). Inhibitors (URB597 1  µM, JZL184 1  µM, WWL70 10  µM, a combination of URB597, JZL184 and WWL70 and a combination of JZL184 and WWL70 at the aforementioned concentrations) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C followed by addition of substrate and incubation for a further 15 min. See above for determination of radioactivity in aqueous phase. Cytotoxicity Assessment/Assay To determine the cytotoxicity of the various treatments throughout this project the LDH cytotoxicity detection kit from Roche (Cat. No. 11 644 793 001) was used per manufacturers protocol. Statistical Analyses Statistical analyses were undertaken by my Supervisor using the function ezANOVA in the package ez for the R statistical programme (R Core Team, URL http://www.R-project.org/). The details and the command lines used are given in Table 2. Epigenetic regulation of endocannabinoid function DU-145 and SH-SY5Y cells were treated for 24h with either Aza dC, TSA or a combination of both compounds, after which mRNA was extracted and analused for expression of marker of the endocannabinoid system. Table 2 shows the summarized data of the statistical analysis obtained in the gene expression studies. Main effects are given in the left half of the table. Significant differences were found for a various number of genes and are given in bold type. Main effects cell describes the comparison of gene expression between DU-145 and SH-SY5Y cells. The columns with Aza dC and TSA describe the effect of the epigenetic modulators on mRNA expression of the gene of interest and only a few of them were statistically significant (i.e. DGLÃŽÂ ² and FAAH for Aza dC and 12-LOX for TSA). Interpretation of the main effects is difficult when there are significant interactions. Values in bold type indicate an interaction between components) for four of the twelve genes of interest. In these cases, individual two-way ANOVAs helped to determine actual differences for each cell line per se. Results of these ANOVAs can be found below their corresponding figures (see Figure 2, Figure 3 and Figure 4) with a P Table 2: Three-way ANOVA summary for the PCR data. Main effects Interactions Cell: Cell: Cell: Aza dC: Aza dC: Protein Cell Aza dC TSA Aza dC TSA TSA TSA CB1 0.0003 0.31 0.060 0.38 0.89 0.14 0.30 NAPE-PLD 0.34 0.40 0.28 0.0093 0.29 0.29 0.54 DGLÃŽÂ ± 0.87 0.88 0.0049 0.49 0.16 0.61 DGLÃŽÂ ² 0.43 0.0004 0.027 0.020 0.031 0.88 0.96 FAAH 0.041 0.0061 0.55 0.17 0.85 NAAA 0.012 0.53 0.44 0.79 0.15 0.40 MGL 0.21 0.019 0.014 0.85 0.25 0.59 ABHD6 0.0004 0.019 0.15 0.0001 0.70 0.43 0.67 ABHD12 0.0078 0.014 0.65 0.091 0.14 0.61 0.11 COX2 0.032 0.62 0.21 0.70 0.83 0.74 5-LOX 0.99 0.45 0.21 0.91 0.98 0.13 0.53 12-LOX 0.0039 0.18 0.0001 0.41 0.55 0.93 0.69 Data shows the ANOVA p values for each protein, calculated for the data expressed as ˆâ€  Ct using the function ezANOVA in the package ez for the R statistical programme. The command line used was Model25). P values in bold type are those where significance remained after implementation of a 5% false discovery rate (Benjamini Hochberg, 199526). When the interaction cell type x Aza dC was significant, two-way ANOVA matching for Aza dC and TSA have been calculated for each cell type separately, and these are shown in the figures. Note that for DGLÃŽÂ ² and MGL the variances were different for the DU145 and SH-SY5Y cells and this will affect accuracy of the P values. In these cases, the cells have been analysed separately and the ANOVA values given in the figures. Cannabinoid receptors 1 and 2 Figure 2: Panel A, mRNA levels for CB1 receptors in DU145 and SH-SY5Y cells treated with Aza dC and/or TSA. The graphs show the individual ˆâ€  Ct values (bars show the means), N=6 per group (each assayed in triplicate), with the corresponding % of controls on the right column. For statistical treatment, see Table 2. Panel B, melting curves for the primers used for CB1 and CB2 receptors. The melting curves are for the DU145 cells. Gene expression analysis data of CB1 mRNA is given in Figure 2A. Expression rates were significantly different between the two cell lines, but neither Aza dC nor Trichostatin A had an effect. No interactions between the compounds and the cell types were found (Table 2) Unfortunately, two different primer pairs, designed to amplify Cnr2 mRNA did not give detectable and reproducible mRNA expression of CB2, so no expression data could be obtained for CB2 (Figure 1B). The first primer pair was taken from a previous publication by Bà ¶rner et al whereas the second pair was designed on site. Figure 1B shows the different melting curves obtained during the qPCR assays for DU-145, with similar results for SH-SY5Y cells. Endocannabinoid synthetic enzymes Figure 3: mRNA levels of the endocannabinoid synthetic enzymes NAPE-PLD (A), DGLÃŽÂ ± (B) and DGLÃŽÂ ² (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panels A and B) or when the variance was different for the two cell types (Panel C). Effects of epigenetic modulation on the expression of endocannabinoid synthetic enzymes are shown in Figure 2. No main effects of either Aza dC or TSA were detected for NAPE-PLD or DGLÃŽÂ ±, there was an interaction between the different cell types and the Aza dC treatment, however (see Table 2). For these samples a two-way ANOVA was calculated and values are given below each figure. Indiviual treatments did not have any significant effect on the expression of both NAPE-PLD and DGLÃŽÂ ± (Figure 2A and B), an additive effect of Aza dC and TSA could be observed for the expression of DGLÃŽÂ ± in DU-145 cells, where expression decreased to a small degree. For DGLÃŽÂ ², since the variance was different for both cell types, a two-way ANOVA was calculated for each. No significant effects were observed for DGLÃŽÂ ² expression in SH-SY5Y cells. However, both Aza dC and TSA had significant main effects in the DU-145 cells, although the sizes of the changes produced by the compou nds were very small (Figure 2C). AEA catabolic enzymes Figure 4: mRNA levels of the endocannabinoid catabolic enzymes FAAH (A) and NAAA (B). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel A). As seen in Table 2, Aza dC had both a significant main effect, but also displayed interaction between the cell types and the compound for FAAH. The two-way ANOVA for FAAH resulted in significant differences only for the Aza dC treatment in DU-145, but not in SH-SY5Y. Once again, the effects were very small in size. Trichsotatin A did not have an effect in either cell line, neither individually nor in combination (Figure 3A). No significant differences were found for NAAA (Figure 3B). 2-AG catabolic enzymes Figure 5: mRNA levels of the endocannabinoid catabolic enzymes MGL (A), ABHD6 (B) and ABHD12 (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel B) or when the variance was different for the two cell types (Panel A). Gene expression analysis of the three key enzym

Death Of A Salesman - Willys I :: essays research papers

“Willy Loman is destroyed by his own ideals'; Willy Loman is a travelling salesman who has worked for the Wagner firm for 34 years. He is now 61 years old and his job has been taken off salary and put on commission. He has a family and he boasts to them that he is “vital in New England,'; but in fact he isn’t vital anywhere. Willy has many strong beliefs that he strives to achieve. He wants to own his own business and he wants to be “bigger than Uncle Charley'; and especially he wants to be a great success and he tries to emulate Dave Singleman. He wishes to die the “Death of a Salesman'; and have many buyers and salesmen mourn for him. He also tries to be a good father, and husband. However Willy’s aims in life have been useless as he hasn’t really achieved anything. He got fired by Howard, his sons are both failures and they abandoned him in a restaurant toilet. His relationship with his wife is plagued by his guilt for committing adultery. He has to borrow $50 a week from Charley. He can’t even keep his mind on one thing for a long time. He can’t drive a car. Willy gets so fed up with all of these things that he want’s to commit suicide and eventually, he does. This topic suggests that Willy’s deterioration occurs because the principals he believes in. To a large extent this is true. After 34 years of Willy’s life, he loses his job. To a normal person under normal circumstances, being retrenched is a time when you feel useless. But for Willy, since everything else is going wrong at the same time, he feels like a useless old man. Willy thought that just because he named his boss, that he would have a secure future with the company but as Charley said “them things don’t mean anything? You named him Howard, but you can’t sell that.'; Even though Willy wasn’t even getting paid a salary, Howard didn’t want him to even represent the company in case Willy “cracked up'; again. Although Willy is mostly destroyed by his own ideals there are other things that destroy him as well, like Howard, Happy and Biff. Willy is emotionally destroyed when Howard fires him. Then, both of his sons disown and abandon him in Frank’s Chop House. Both Happy and Biff left their father talking to himself in the bathroom while they wanted to have a good night out with the girls.

Use of detailed satire in modest proposal :: essays research papers

The use of detailed satire through A Modest Proposal The use of detailed satire is very evident in A Modest Proposal. A writer’s hand that brings the reader’s eye to the effect of sociopolitical policies on the Irish by the English landlords and politicians in the early 1700s, could have only belonged to Jonathon Swift. Swift skillfully addresses â€Å" the suffering caused by English policies in Ireland † as well as holding the Irish accountable for their â€Å"passivity.†   Ã‚  Ã‚  Ã‚  Ã‚  Swift begins by using a gradual egression, setting the tone of the current situation in Dublin, only to shock the reader at his proposal of cannibalism, specifically of young children, to help alleviate the economic burdens imposed by the English and accepted by the Irish. In laying the foundation for his proposal, Swift suggests the benefits for all:   Ã‚  Ã‚  Ã‚  Ã‚  But my intention is very far from being confined to provide only for the children of professed beggars; it is of a much greater extent, and shall take in the whole number of infants at a certain age, who are born of parents in effect as little able to support them as those who demand our charity in the streets. Swift continues on, using excruciating detail, suggesting preparation for dining, the appropriate number of dinner guests the young child will feed, and the price of such a feast. All the while this morbid suggestion is detailed rationally. Swift brilliantly targets the English landlords when he addresses the price of the food, and how it is appropriate since â€Å"as they have already devoured most of the parents, seem to have the best title to the children.† Swift’s use of detail purposely takes the reader away from the proposal to show the examples of how cannibalism has worked elsewhere, only in a satiric effort to show the reader this is not the way to improve the city of Dublin. The build-up of this proposal continues to its conclusion where Swift has taken the reader to the actual expedients, although rejecting them for no hope of them ever being

Radio Frequency Identification :: Technology, Electromagnetic Radio Waves

RADIO FREQUENCY IDENTIFICATION Introduction RFID is a technology which enables detecting and identifying objects using electromagnetic radio waves. This is processed through exchange of information between a reader and a tag being attached to the object that includes the data associated with the object. This can be used to detect and classify vehicles, animals, patients, shipment goods and airline baggage. [1] RFID technology involves two main components, they are transponders which are also known as tags or labels, contain the relevant information about the object and other the interrogators, also known as readers or transceivers, that extract the data from the tags. These tags can be passive or active tags. Passive tags use the energy from the EM radiation of the reader for its processing, where as active tags receive power from an internal battery for its processing and communication with the reader. An integrated electronic circuit is embedded in tags for storage and processing operations and an antenna that transmits and receives the RF signal. [2] Figure : components of RFID Source : http://www.docstoc.com/docs/17328767/Draft-SP800-98 The tags used in RFID are enabled with read-write operations, with a large storage capacity. Data can be modified any number of times. Tag and reader act as two way radio communication in which each antenna carries the modulation and demodulation of RF signals, with operation frequency ranges from low frequency to UHF. As radio waves are used, RFID does not require line of sight for communication and the operating distance between the reader and tag varies according to the frequency range from few centimetres to few meters. [3] [1] http://en.wikipedia.org/wiki/Radio-frequency_identification [2] [3] http://www.docstoc.com/docs/17328767/Draft-SP800-98 History The start of RFID took place in 1915, by the British with a system called IFF, which means Identification Friend or Foe. In 1940, during Second World War, the first installation of IFF transponder was in a German aircraft named FUG. [4] Leon Theremin, in 1945 invented a device which retransmits an incident radio wave and audio information. This passive device which was activated from an external source became the forerunner for RFID technology. [5] The concept of RFID came into existence in 1973 when Mario Cardullo invented a passive transponder which emits information when activated by an interrogating signal and consisted a 16bit memory unit for storage purposes. [6] In 1973, at the Los Alamos National Laboratory, Steven Depp, Alfred Koelle, and Robert Freyman developed the RFID tag system that uses 12bit tags, operating at 915 MHz. [7] After many years of research RFID tags came out with active tags that eliminated the use of external power source.

African-American Civil Right Movement

The African-American Civil Rights Movement During the frail moments in history there are times to be seen as a great movement. One of those moments in the history of America was the African-American Civil Rights Movement. This movement came by storm with different views on how civil rights should be fought. With the extremism of Malcolm X or the prolific voice of Dr. Martin Luther King Jr. There were key court cases Brown v. Board of Education and the world wide known Rosa Parks. This action by African-Americans to fight for equality was a battle which they had to endure.However, the African-American people would be able to succeed in the goals which they set. One of the greatest social movements within the United States was the African-American Civil Rights Movement. This movement wanted to rid or outlaw racial discrimination against African-Americans. The movement had a major campaign of civil resistance which were acts of nonviolent protest and civil disobedience that would create a disturbance to federal, state, and local governments. The segregation between â€Å"White† and â€Å"Colored† was the main cause for these protests. The segregation was nonsense.With separate drinking fountains, restrooms, and other miniscule areas the segregation between whites and coloreds kept the rift between these two races. Dr. Martin Luther King Jr. is known for his heroic speeches that describe that to thrive as a nation, a nation must be united. With his superior charismatic skills he was able to grab the attention of the nation. His most famous speech which is known by most as â€Å"I have a dream† speech was the high point of the 1963 March on Washington. Another leader during the African-American Civil Right Movement was Malcolm X.Though many peers viewed him as a advocate that charged racial issue, he undoubtedly brought the attention of racial injustice. An example of his actions was a New York Police beating on Johnston Hinton. Malcolm X went t o the police station to see Mr. Hinton and was denied. Malcolm then created a crowd of protesters and with the growing numbers of his peers the police station then allowed him to see Hilton. It was protests like these which lead the charge to equality throughout the nation. But there were also key law suits and court cases that would make justice history.During a movement there has to be examples to which are known, and can be used to show either the highest achievements of the movement or show how the old justice system is broke. It was the series of court cases known as Brown v. Board of Education. This case was brought to the attention of the court system to allow the education of Black and White Children. The lawyers of the NAACP stated that segregation of the school were unconstitutional and did not promote democracy. With this on May 18, 1954 Greensboro was the first city in the South to execute the ruling of the U.S. Supremes Court’s Brown v. Board of Education. This h ad a positive effect for the movement forward to equality. Another famous court case was the Rosa Parks and the Montgomery Bus Boycott. Due to her actions taken on December 1, 1955, Rosa Parks was dubbed â€Å"the mother of the Civil Rights Movement†. Rosa Parks refuse to leave her seat on a public bus to leave room for a white passenger. She was arrested, tried, and convicted for her actions that day. However, due to this incident 50 African-American leaders organized the Montgomery Bus Boycott.With the support of approximately 50,000 African Americans in the Montgomery area, the boycott lasted for 381 days. The results of this boycott lead to the local segregating of African-American and Whites to be lifted. With the mass amount of boycotters the revenue for the bus decreased 80% until a federal court ordered the Montgomery’s bus service to desegregate in November. Other legislative achievements during this movement were the Civil Rights Act of 1964, Voting Rights Ac t of 1965, and the Fair Housing Act of 1968.With the African-American Civil Rights Movement being a concrete example of the determination of making a nation move forward to a more acceptable place, it was due to these key people which stood up a led a group whom wanted the same privileges as those whom already had. A movement with such importance must be taught and understood. During any movement in history there will always be those who emerge as leaders, sometimes those want to be a leader and some of those who are leaders unintentionally and lead by peaceful actions.These movement leaders: Rosa Parks, Malcolm X, and Dr. Martin Luther King Jr. made history which will be concreted into the books of history and will be forever known as leaders in the African-American Civil Rights Movement. End Notes 1. Henretta, J. A, Brody, D. , America a Concise  History, Volume 1, Fourth Edition. Boston: Bedfords/St. Martin’s, 2012. 2. Bruce, Perry, The Last Speeches, (New York: Pathfind er, 1998) 978-0-87348-543-2 (accessed October 8, 2012), 165. 3. Klarman, Michael J. ,Brown v.Board of Education and the civil rights movement: abridged edition of From Jim Crow to civil rights  : the Supreme Court and the struggle for racial equality, Oxford  ; New York  : Oxford University Press, 2007, p. 55 4. Chafe, William Henry, Civilities and civil rights: Greensboro, North Carolina, and the Black struggle for freedom, (New York: Oxford University Press, 1980) 0-19-502625-X (Accessed October 8, 2012), 81. Bibliography Henretta, J. A, Brody, D. , America a Concise  History, Volume 1, Fourth Edition. Boston: Bedfords/St. Martin’s, 2012. Perry, Bruce. The Last Speeches. New York: Pathfinder, 1989. 78-0-87348-543-2 (accessed October 8, 2012). Klarman, Michael J. ,Brown v. Board of Education and the civil rights movement: abridged edition of From Jim Crow to civil rights  : the Supreme Court and the struggle for racial equality, Oxford  ; New York  : Oxford Uni versity Press, 2007 Chafe, William Henry (1980). Civilities and civil rights: Greensboro, North Carolina, and the Black struggle for freedom. New York: Oxford University Press. p. 81. ISBN 0-19-502625-X. ——————————————– [ 1 ]. J. A. Henretta, and D. Brody, America a Concise History, (Boston: Bedfords/St.Martin's, 2012), 828. [ 2 ]. Bruce Perry, The Last Speeches, (New York: Pathfinder, 1989)978-0-87348-543-2 (accessed October 8, 2012), 165. [ 3 ]. Klarman, Michael J. ,Brown v. Board of Education and the civil rights movement: abridged edition of From Jim Crow to civil rights  : the Supreme Court and the struggle for racial equality, Oxford  ; New York  : Oxford University Press, 2007, p. 55 [ 4 ]. Chafe, William Henry (1980). Civilities and civil rights: Greensboro, North Carolina, and the Black struggle for freedom. New York: Oxford University Press. p. 81. ISBN 0-19-50262 5-X.

Joining the Navy Essay

It was a rainy, humid morning on Wednesday, October 8, 2008, a day I could never forget. I turned over calmly and realized it was 4:30am, time to get out of bed. It was the big day. All these thoughts were racing through my head. â€Å"What am I doing? Am I sure this is right for me? Will I succeed in this? † I was timid, excited, and fluttered all at the same time. It was the day I’d no longer be a civilian. Eight weeks from that day I’d be calling myself a United States Navvy Sailor. As I woke up and started to get ready, I could feel goose bumps Jitter up my spine. What occupied my mind was the thought of leaving my family. I was the last child still living at home. My brother’s were already gone. Would my parents be able to cope? I know my dogs would miss me terribly. It was time to depart to the recruiting office. From there, NCI Valencia had to drive me to the Military Entrance Processing Station. That day felt like a surreal blur. NCI Valencia would give me advice with a big grin on his face, and I would hear him, but not listen. My nerves were overpowering my body and I couldn’t manage them. I then pent the whole day in a building completing all these exams to make sure I was hearty and robust to leave. That day was the longest day of my life. Looking around, I felt at ease. All the other recruits were giving out the same body language I was giving. We were all feeling the same feelings and thinking the same thoughts. I wasn’t alone. It was time for the Oath of Enlistment Ceremony. A few men in sailor uniforms brought all the recruits into a room with a variety of flags. My family was the only family that attended to take pictures of the big event. I then elevated my right hand, hile standing in the position of attention, and reiterated after Chief, â€Å"l, Amanda Lazcos, do solemnly swear (or affirm) that I will support and defend the Constitution of the United States of America and†¦ † Using my peripheral vision, I noticed my mother crying. Keeping my emotions intact was extremely arduous. Think about this: I was embarking on a new Journey and leaving the two most important people in my life at the age of 19. This was the first time I would be away from my parents for a long period of time. It was a life-defining moment. The event had come to a close. It was now time to say my farewells. At this point, it was nearly impossible to even glance at my family. Looking at them would make me realize how much they mean to me. I tried to make it quick and simple so I wouldn’t shed a flood of tears. The last scent I reminisced on my mother was her Sunflowers perfume. She adored (and still does) that perfume. My father had this truly glorious look in his eyes. I knew he was so delighted to see me doing something positive towards my future. At the same time, I knew he was going to miss me a lot. In an instant, I was on the bus, and off to the airport along with 37 other recruits.

The goal of Lucky Inc.

Is to develop a foremost business owner of the traveling agency for the individual of the age range from about 20 to 30 year old. Lucky Inc. Will be devoted to establish stronger relationship within their clients via extensive lesson of how to treat guest and sever them the best service, and would like the company to well popular among the clients and other publics as the most popular tourist agency in the Ideal area. The main focus of the firm would be to gradually develop, and become successful by the first few years of operations.Our main goal would be to provide an excellent professional facility through demonstrating an adequate understanding of the places that individual would like to travel to and adventurous events that will be held. On an industrial report stated that the biggest disparagement of the variety of customers that has been to the tourist companies that already exists â€Å"know nothing about their products, they Just open the catalogue and read,† to quote one of many disappointed travelers (Blackwell, 2008, p. 332).To make the most of over the knowledge and skills we gained in the Lucky Inc. Apparel store, staff would to both educate and instruct the customers to the various types of vacation accessories that they might be wanting of to have the quality vacation time they planned out while they are in the Ideal area. Products and Services Recently, Lucky Inc. Became as the allotted agents for Ideal's Travel, which will be the biggest and popular traveling agency out in the marketplace. However, per almost with no advertising, Lucky Inc. As sold about 200 adventure vacations in the past several months, netting about $56, 800 in commissions including the sales of insurance policies and other services also have calculated to this amount, and could possibly add much more. Lucky Inc. ‘s clients will also be offered to have the opportunity of an inclusive variety of facilities to services to help their exciting tour, including semina rs of before and after trip, tourist coverage, and a booklet of specific offers to each vacation place, etc.I plan to sell my share in the apparel store and finance the profits in my potential new company which will be a traveling agency as Lucky Inc. Moreover, I would be also financing $51, 600 of my savings from the past ears in this company, and take loans of $70,000 probably from friends and relatives. Furthermore, the return on shareholders capital by three year is anticipated to be close to 100 percent. The perseverance of this business plan is to converse this high profitable opportunity to my co-owner in the clothing shop and to the other investors of different organizations to encourage their interest in the venture.Alternatively, I'm also thinking of a loan finance made up of a $31,940 for about couples of years and a credit line of $48,620. In total, I will be in need of about $80,560 to fund the company or the first few months. The majority of the population of Ideal Cou nty is well educated, experienced, active, and pretty stable. The residences of the county also and wait out past periods of economic downturn. The dynamic economy, the lifestyle of Ideal County, and its exceptional environmental qualities attract people.Moreover, both public officials and business leaders are also aware of the need to keep our labor force well-armed with the marketable skills. From the Ideal County population, our potential targeted clients are the people who are professionals with annual earnings of about $50,000+, ages 20 to 30, whether single or married, without children, and college educated. Market Definition The projection of the world travel market is to grow about at greater than 4 percent average annually.I believe that this is somewhat faster than our general economic growth every year. I also planned to advertise my company outside of the United States. Hence, I selected such market like the European market, which is not the firmest growing market, and I believe this will be the most important destination, considering most the travelers will be international. I also think that among Europe, France, Italy, and Spain are the most popular destinations. Therefore, I decided to select tour operators with appropriate products in these areas as our initial partners.Business model The business model that will be used for this company is a distributor which is any business that purchases products directly from a manufacturer for resale either to retail outlets or directly to the buying public (Digging, 2012). For instance, a technology distributor would purchase computer parts from a technology manufacturer and then sell those parts wholesale to retail outlets for sale to the neural public (Digging, 2012). An auto dealership that deals in new cars would purchase vehicles directly from the manufacturer and sell them to the general public (Abram, 2003).According to the University of Southern California, Wall-Mart Department Stores qualifies a s a distributor because it purchases product directly from the manufacturer. Not all department stores have that kind of purchasing power (Digging, 2012). We will also be leasing a combined telephone/data-base system from the onset. This will beneficial by allowing up to ten sales staff to answer alls and have full on-screen data on clients and products. As service is one of our key components, it is essential that we have full access to all relevant data speedily and efficiently.However, there might be times that will not be possible to meet other locations, etc. Therefore, I should always be prefer for the worse and make sure that my staffs are well trained to provide the best customer service to my clients. Since, we are successfully operating the outdoor clothing shop; hence, we are using the adventure travel vacation sales ratio to study how many of them we are being able to sale on up to date. For the determinations of our sales projection, we believe hat that only about two i n five reviews will essentially effect in an adventure vacation being reserved.However, I believe this is a very conservative evaluation. I also undertake that there will be a firm accumulation of customers of the clothing shop who will approach us to learn more about the vacation packets and the destinations. Throughout the year we will also be able to bring in more clients by creating more promotional activities and of course our new clients of the clothing store. I am pretty hopeful that we will continue to strive with this trend to make Lucky Inc. To become well known.Based on the prediction, within next year we are projecting to sell about 600 adventure travel vacations for an estimated price of $3000. We also predicted that if we add insurance and other travel related service sales the gross profit will be nearly $ 2500,000 throughout the first year. Reference Abram, Rwanda, (2003). The successful business plan: secrets ; strategies. Plato Alto, Cilia. : Planning Shop Blackwel l, Edward (2008). How to prepare a business plan. London; Philadelphia: Kananga Page Digging, Charles, (2012). The power of habit: why we do what we do in life and business. New York: Random House

Genetic engineering †Maize Essay

Introduction Genetically modified, by definition, is a term denoting or derived from an organism whose DNA has been altered for the purpose of improvement or correction of defects. (dictionary. com) Genetically modified foods are foods that have been altered to enhance certain traits for the purpose of making them more desirable to consumers. Since the development of this process, modified foods have become more common throughout the years, and with their increase in production there has also been great controversy. History of Genetically Modified Foods In 1994, the first genetically modified food the Food and Drug Administration deemed safe enough for human consumption was a tomato called the â€Å"Flavr Savr,† produced in California. The purpose of altering the tomato was for it to be resistant to rotting and decaying as quickly as tomatoes usually do. They were not labeled as being genetically modified and they were between two and five time more expensive than ordinary tomatoes, but consumers still purchased them. However, due to competition, brought on by a tomato made conventionally and with a longer shelf life, the Flavr Savr tomatoes were not profitable. Genetically modified tomatoes were then made into a tomato puree and sold in Europe in the mid-1990s, but a couple years later controversy arose over the concept of genetically modifying food. In 1998, a doctor from Aberdeen, in Scotland, published results from a research study he conducted suggesting that genetically modified potatoes, injected with an insecticide gene from the snowdrop plant, were toxic to rats. A year later it was announced that beginning in 1999, there were to be trials of genetically modified crops engineered to be resistant to herbicides. The purpose of the trials was to uncover the effects of these crops on farmland wildlife. However, this was criticized to be potentially dangerous to nearby crops, as well as honey that could be affected by cross-pollination. Sure enough, later that year pollen from genetically modified oilseed rape, a plant that is used to produce canola oil, was found at beehives almost three miles away. Two out of nine samples of honey being sold in supermarkets were contaminated in May 2000. At this point in time, nine out of ten people were against the idea of genetically modifying foods. (dailymail. co. uk) Despite the controversy surrounding genetically modified plants and foods in earlier years, technologies have advanced, and in 2006, 10. 3 million farmers planted 252 million acres of transgenic crops in 22 countries. The United States, Argentina, Brazil, Canada, India, China, Paraguay, and South Africa grew 97% of these crops. Soybeans, corn, cotton, canola, and alfalfa were modified to be herbicide and insect resistant, whereas other crops, like sweet potatoes for instance were modified to be able to survive harsh weather conditions. (Ornl. gov) The process of genetic modification Genetically modifying foods changes their genetic makeup in some way. The purpose of doing this is to enhance certain aspects of the food, for example, increasing its resistance to herbicides or its nutritional value. Traditionally, this has been done by way of selectively breeding plants or animals for specific genetic traits, however this method has proven to be potentially inaccurate and very time consuming. Genetic modification on the other hand can physically isolate a particular gene and insert it into another substance, enabling it to then posses that quality. This is done very quickly and accurately. Plants can be made insect resistant, virus resistant, or more tolerant to herbicides. Bacillus thuringiensis is a bacterium that produces a gene for toxin production that is safe for human production. To achieve insect resistance, the gene is injected into the crops that will then be able to produce this toxin on their own, leading to a decreased need for insecticides. To achieve virus resistance, crops must be introduced to the gene from that particular disease-causing virus. This results in less susceptibility to the disease and higher crop yields. Similarly, to achieve herbicide tolerance, a gene from a bacterium that will transmit resistance to some herbicides must be injected into the crops, in turn reducing the amount of herbicides used. Purpose of genetically modifying foods. There are many reasons for producing and selling genetically modified foods over those that are traditionally produced. Originally, the intent was increased protection of crops. This is still one of the process’ objectives, however there are many additional benefits recognized today. Both consumers and producers who feel that genetically modified foods are advantageous believe that these foods can be cheaper, more durable, and more nutritional. Genetically modifying foods is also a way to ensure that with a world population that is predicted to double in the future, a food shortage will not be encountered. In addition to increased protection from diseases, pests and herbicides, there are other key reasons for genetic modification. Many crops are destroyed due to troubling weather conditions. Frost can come at unexpected times causing destruction to sensitive crops. Cold water fish have an antifreeze gene which, when introduced to plants like tobacco and potatoes, can lead to a higher tolerance to cold temperatures. Similarly, plants can also develop the ability to withstand droughts. A very important quality of food is the nutritional value that is possesses. Malnutrition is quite prevalent, especially in third world countries where people tend to rely on only one crop to fulfill their dietary needs. If however, these crops could be genetically modified to contain the amount of vitamins and nutrients necessary to sustain a healthy diet, it would be a great advantage. For example, in third world countries blindness caused by a vitamin A deficiency is very common, so researchers at the Swiss Federal Institute of Technology Institute for Plant Sciences have developed what they call, â€Å"golden† rice, which contains uniquely high levels of vitamin A. The hope in this development is that this rice, funded by the non-profit organization Rockefeller Foundation, can be sent to any countries that request it. Vaccinations and medicines can be very difficult to produce, and they can also be very costly. Through genetic modification there is hope that the ability to produce foods with edible vaccinations in them will become a possibility. Common Genetically Modified Foods According to a WebMD article, experts say that about sixty to seventy percent of processed foods sold in the United States contain genetically modified ingredients. Soybeans, , corn, cotton, and rapeseed oil are the most commonly genetically modified foods. In other words, any foods that contain field corn, high-fructose corn syrup, soybeans, cottonseed oil, or canola oil all contain genetically modified ingredients. These ingredients are extremely common in most foods, much more so than most people are aware of. According to a study funded by the United States Department of Agriculture, only 52% of Americans are aware that genetically modified foods are even sold in grocery stores. The United States is the largest producer of corn in the world, and in 2000 it was estimated that 25% of corn crops growing in the United States were genetically modified. Corn is an ingredient in beer, salad dressing, margarine, flour, and anything containing corn syrup. The corn sold in stores is not necessarily intended to be genetically modified, however the concern for cross contamination between crops is there, since corn is wind-pollinated. Soy is the most heavily modified crop, and more than half the soy in the world was made up of genetically modified strains in 2007. There are different reasons for the modification of soy, including an added resistance to insects, and increasing its vitamin or fat and protein content in order to be suitable for animal feed. Soy is also used for creating chemicals used in pharmaceuticals. The likelihood of products in the United States containing genetically modified materials if they contain soy is very high, despite the lack of any labeling stating so. Tofu and soy milk are obviously effected products, however soy is also present in bread, cereal, ice cream and chocolate. Milk can be made from a genetically modified hormone called the recombinant bovine growth hormone. The function of this hormone is to produce more milk by keeping cells to produce milk alive in cows for longer periods of time. There is no proven difference between milk produced with the hormone versus that produced without it, however cows injected with the hormone are more prone to disease which can in turn have negative effects on the milk. Rapeseed oil, or canola oil, is one of the most genetically modified crops used. 80% of canola crops in Western Canada have been genetically modified. It is modified in the area of herbicide resistance. Also, modified rapeseed crops produce the main pollen used in the making of honey, suggesting that most honey from Canada could likely qualify as genetically modified. Advantages of Genetically Modified Foods Genetically modified foods offer several advantages. As already mentioned, an increased resistance to pests and diseases, the tolerance against bad weather conditions, and an increase in food supply are all obviously positive aspects. Crops have a better taste and quality when they are modified and they also have increased nutrients, yields, and stress tolerance. The time it takes for crops to mature is reduced as well. As far as the advantages for animals, they develop an increased resistance, productivity, and feed efficiency. They also produce more food, and their health can improve. The environment can benefit from genetically modifying foods as well. Firstly, the bioherbicides and bioinsecticides are environmentally friendly. Because genetic modification improves the resistance of plants and reduces their maturation time, soil, water, and energy can also be conserved. There is better natural waste management associated with genetic modification, and food processing is more efficient. Disadvantages of Genetically Modified Foods Despite the advantages of genetically modifying foods, the disadvantages of doing so seem to greatly outweigh the positive aspects of it. The most common criticisms against GM foods are in regards to the environment, health risks, and economic worries. Firstly, there have been several harmful, yet unintended effects on organisms in the environment. Monarch butterfly caterpillars have suffered an increased mortality rate due to the gene injected in corn crops. Though the caterpillars do not consume corn crops, they consume milkweed plants in neighboring fields, where the wind could easily transfer the pollen. There was a study done to test this theory, and the study did in fact support it. Another environmental concern is that the genes used to enhance certain crops will be transferred over to species unintended to contain the gene. For instance, in the case of crops that are introduced to a gene enabling them to develop an increased resistance to herbicides, the gene can potentially spread into the weeds themselves, causing them too to develop a higher herbicide resistance. This could cause problems because the weeds would then become very difficult to combat which could possibly ruin the crops. The concern for human health risks in regards to genetically modified foods is very high as well. Firstly, food allergies are very common among people in Europe and the United States, and in some cases these allergies can be fatal. The possibility that adding genes to plants could cause allergic reactions in susceptible people is there, and it is a very threatening possibility. Secondly, genetically modified foods pose an unknown overall threat to human health. Despite the lack of proof that foods made of genetically modified materials can be harmful to people, there have been studies showing that certain GM foods are in fact harmful to the digestive tract of rats. Just the fact that the effects of GM food on people are still not completely known also poses a huge threat in itself. From an economic perspective, genetically modifying foods is very costly. With new technologies that are continuously surfacing, companies are starting to want to patent their ideas, and this raises the concern that with patents will come a raise in price of seeds, making business very difficult for farmers who will not be able to afford them. This would result in the domination of food production throughout the world by only a few companies if GM foods reached such a high existence. It would also increase the dependence of developing countries on industrialized nations. Lastly, it could also result in biopiracy, or foreign exploitation of natural resources. There are ethical issues surrounding genetic modification as well. Many people question if it is unethical to alter nature by taking the genes of one species and mixing it with another. There is also the question of whether or not it is ethically wrong to violate the essential values of organisms. This process can stress animals as well, as their natural ways of life and food production are being compromised in ways that are having essentially unknown effects on the animal. The ethicality of labeling foods as genetically modified is a very controversial issue. In the United States, labeling foods is not mandatory and to the many people who do not want to consume these foods, this is viewed as very unethical. Laws of Genetically Modified Foods The laws and governmental regulations of genetically modifying food varies throughout the world, yet a common factor is that all of these different governments are in fact working towards establishing regulatory processes. In Japan, as of April 2001, testing GM foods was made mandatory. In the United States, regulation is achieved by several different governmental agencies, such as the US Environmental Protection. Agency, the US Department of Agriculture, and the US Food and Drug Administration. The EPA is responsible for regulating the substances used that may cause possible harm to the environment and human health, pesticides for example. Farmers need to obtain licenses in order to use such chemicals, and the amount they are permitted ot use is regulated. The USDA includes different divisions each responsible for their own branch of assessment. â€Å" Among these divisions are APHIS, the Animal Health and Plant Inspection Service, which conducts field tests and issues permits to grow GM crops, the Agricultural Research Service which performs in-house GM food research, and the Cooperative State Research, Education and Extension Service which oversees the USDA risk assessment program. † (Csa. com) The FDA is involved when companies producing GM foods have issues they feel they want to consult with them about. They are not required to go to the FDA though. The future of Genetically Modified Foods Currently, genetically modified ingredients are present in many foods, however the process is mostly limited to altering the ingredients in the area of improved sustainability. In the future, there are plans to genetically modify much more. For example, there are plans to try to produce foods with the ability to produce human vaccinations. There are also plans to genetically alter food animals, like pigs, cows, and most recently salmon. Conclusion Genetically modified foods have come a long way since their first introduction into the market. They have great potential to solve many problems and improve upon many conditions. However, there are many challenges facing governments as far as the advancement of genetically modified foods is concerned. Regulations, food testing, and uncovering more of the possible effects on both human health and the environment are all great issues involved. The concept of genetic modification is also very controversial. However, regardless of the obstacles and controversy surrounding this phenomenon, it is becoming much more widespread throughout the world. Works Cited â€Å"Genetically Modified Foods: Harmful or Helpful? † CSA. Web. 24 Oct. 2010. . â€Å"Genetically Modified Foods and Organisms –HGP Ethical, Legal, and Social Issues. † Oak Ridge National Laboratory. Web. 24 Oct. 2010. . â€Å"Development and History of GM Foods – Genetically Modified Foods (UK). † Comphrensive Advice on Genetically Modified Foods at Genetically Modified Foods (UK). Web. 24 Oct. 2010. . Chapman, By James. â€Å"History of Genetically Modified Food | Mail Online. † Home | Mail Online. Web. 24 Oct. 2010. . Jibrin, By Janis. â€Å"Genetically Modified Foods (Biotech Foods) Pros and Cons. † WebMD – Better Information. Better Health. Web. 1 Nov. 2010. . dictionary. com.